Tiger Swallowtails of NY: Finger Lakes, Part II

[Chuck]

25july2023: back to the primary survey site on the hilltop. 27C, low grey cloud cover.

11 spotted, six captured. All captured were on Bergamot.

Many were flying around, sampling the Bergamot, and leaving. I attribute this to the lack of direct sunlight.

Oddly, Papilio troilus < 10 spotted; some of this due I'm sure to lack of sunlight, but this time last year there were hundreds. Still a few fresh female Speyeria cybele around.

Finished off by checking the cup plant field, no Tigers spotted. Many of the cup plants are still under 2m tall, so it may be more than a week before the Tigers migrate to the cup plants.

[Chuck]

26 July 2023: Sunny, 31C, breezy


First, primary site on hilltop. Three Tigers spotted, two captured. Of the two captured, one was nectaring on Bergamot, the other bouncing around tasting Bergamot. The one not captured simply blasted straight across the field. Where are they all?

In 2022, about 30 July they left the Bergamot and went to Wild Teasel. But I checked the Teasel fields, and the Cup Plant field, nothing. Where are they?? This day last year was the second-highest capture of 2022. Where are they? Where did they go?

Also, < 5 troilus spotted.

[Chuck]

Check out the extremely long tail(s) on this Mid Summer Tiger. Both tails are equal length.

@eurytides note too the darker/ speckled clasper.



I didn't notice the tails when captured, nor when set. Only when I pulled it off the board.

[mothman55]

I have never seen tails that long, impressive.

This season I have noticed more MST in Central Ontario than in the past. This July I have seen at least one on most of my outings, generally I only see 3 or 4 for the month.

[Chuck]

Just looking at iNat for MST observations this year, seems to be a high number in southern Ontario, with a good underside shot of one way up/ over the Bruce Peninsula. https://www.inaturalist.org/observation ... _id=468756

Here's a puddle party in Algonquin, so about as far north as MST is reported; oddly enough the lunules look more glaucus https://www.inaturalist.org/observations/174033668


I looked at UP Michigan since 01 July, and they apparently don't use "canadian x eastern"; all of the Eastern shown are in the south of UP, and the canadensis observations I really can't say they're canadensis, except for one, and there aren't many. So the "hybrid zone" seems to be pretty inactive. Does MST not occur in UP Michigan?

[Chuck]

28 July 2023: 32C, sunny. 10 observed, five captured.

Primary hilltop field: Bergamot starting to yellow and drop flowers, though the field is still aflower. All Tigers captured were bouncing from plant to plant, apparently dissatisfied. Others just blasted across the field.

Checked the mixed patch of Cup Plant and Teasel, nothing.

Caught one tired Tiger on Teasel near the large Cup Plant field; first one on Teasel in 2023. None spotted on Cup Plant.

Checked a new patch of Cup Plant, nothing. Checked a new patch of Teasel, nothing.

Saw more Papilio troilus, more than a dozen. Only one male. The male, and several of the females, were dark and fresh.

The Speyeria were very aggressive today, chasing everything including large darners, Papilio, and birds. Many male-male battles.

[eurytides]

Yeah, seems to be an exceptionally good year for them. The long and thin tail is a great aberration on that specimen. I also noticed the claspers before seeing your comment. This is a canadensis-like trait. It used to be thought that MST had pure yellow claspers, like glaucus. But now it seems that no longer holds.

[Chuck]

Yeah, seems to be an exceptionally good year for them. The long and thin tail is a great aberration on that specimen. I also noticed the claspers before seeing your comment. This is a canadensis-like trait. It used to be thought that MST had pure yellow claspers, like glaucus. But now it seems that no longer holds.

I'm not certain that MST is one taxon; I'm more thinking it's a very complex recombinant hybrid that demonstrates variation within both the taxon and within some populations (i.e., some populations have more canadensis than others that might be only a few km away.) I'm suspecting a time-related component as well, with (in some areas) MST looking more like glaucus in August; or, it could be glaucus (I don't think so though.)

I spent 28 July - 06 August working my way up the NY Lake Ontario shoreline, coming very close to where Eurytides lives. No Tigers observed. I stopped at the local Dept. Environmental Conservation office, and they said they'd not seen any Tigers either. I did seem them flying around in NY Wayne County though.

08-11 August in Huntsville, saw zero. Cool and severe storms though.

[Chuck]

14 Aug 23, 23C 9/10 cloud cover: ~20 seen, six captured (only 1 male)

Yesterday, after two weeks away from home, I remarked to my wife "ugh I have to trudge up to the top of the hill tomorrow." And then realized- no, I don't! The bergamot is past flowering, so the Tigers would be on the cup plants. I was elated- no more 15 minute climb.

Today I remembered why the change to the cup plant field isn't really an improvement. I can look over the field from a knoll, but when I drop into the 4+ meter tall cup plants I can't find the darned Tiger and it's brutal to get through those plants. I was pouring with sweat in minutes.

Most of those seen are beat; I attribute this partially to the severe storms that swept through two days ago, and part to the plants. Even the females with huge abdomens (indicating haven't laid ovae) have split and chipped wings.

Below: from the "other" side of the cup plants, looking at the knoll. Between the yellow cup plants you see and the knoll is a swale, and in it are the densest, tallest cup plants- terrible terrain. From the point the photo was taken I'm on a bit of rise, and the plants don't look 4m tall, but they are. Also, spotting Tigers on the yellow plants is impossible unless they move.

[Chuck]

16Aug23: 24F, 9/10 cloud, following 24 hours of soaking rain. Cup plant field.

2 observed, 2 captured. Both males- one old and beat, the other fresh. There were no other Tigers. It started to rain again, I left.

June 2021 and June 2022 were horrible with constant cold fronts, severe storms, and rain. 2023 had been the same, but it continued into July, which was the rainiest July on record. It has also carried into August.

[Chuck]

17Aug23: 28C, 10/10 cloud cover, breezy.

Five spotted, one captured. Two were just fly-bys, others on Cup Plant and I just could not get to them. All seen today were damaged, most were completely wrecked; one had almost no hindwings and the FW were ripped up with little scaling left, but somehow it could still fly.

A few Speyeria cybele flying about, those rugged troopers. They are absolutely beat but won't die.

[Chuck]

18Aug23: 20C, on-off-rain, very windy

Didn't look for Tigers, given conditions.

While standing on the back deck during a brief bit of weak sun I was attacked by a Papilio cresphontes. It was flying very weakly and was badly worn. I was wearing a bright lime green shirt, which is what I suspect attracted it. It's the only one I've seen- anywhere- all year. Despite three grab attempts with my hand, and brushing it twice, it flew away.

[Chuck]

I found an error in a publication. It's rather obvious, but thought I'd note it:

THE POPULATION BIOLOGY OF TWO EASTERN TIGER SWALLOWTAIL SUBSPECIES (PAPILIO (PTEROURUS) GLAUCUS GLAUCUS L. AND P. G.MAYNARDI AUTHIER) (LEPIDOPTERA: PAPILIONIDAE), AND ITS CORRELATION TO THE NORTHERN-FLORIDA SUTURE ZONE by Matthew Steven Lehnert, 2010

page 102



the correct ID is:
(A) glaucus female
(B) glaucus male
(C) maynardi female
(D) maynardi male

[Chuck]

22Aug23: 25C, mostly sunny. Cup Plant field. Zero observed.

Last few days were very stormy and cool. This morning was 11C.

[Chuck]

Here's a screen capture of iNat observations for Eastern Tiger Swallowtail for the past five days.



Note if you will, the near absence of Tigers in Upstate NY and northern PA.

Probably not ironically, with the exception of the observations from eastern Ontario Canada, this matches almost exactly a map I'd previously posted showing the North-Eastern limits of the dark female Papilio glaucus.

I checked observations for WI and MI, and there are dark females. None of the observations shown for SE Ontario CA have dark females.

So, suddenly, the Tigers that do not have a dark morph female have virtually disappeared.

[Chuck]

01 Sept: One Tiger observed flying across the road; appeared fresh.

The past 10 days or so have been cold and rainy. 01 Sept started cold and quickly warmed to 27C. Forecast for the days following was sunny and 32C.

[Chuck]

Set some frozen specimens and found another "long tail" this one dating to 13 July 2023; the one previously posted was 21 July 2023.




OK, so the last Finger Lakes Tiger was observed on 01 September. No doubt they are now long done.

So back to KY to see what's there, and fortunately I got eyes on one beat female.



I guess that's a wrap for field work.

About KY though, I noticed that their thistle blooms later than in Finger Lakes, and as can be seen is still blooming while in Finger Lakes it went to seed before 01 Sept. Interesting.

Also in KY there were many fresh Limenitis arthemis astyanax!


As a side note, in KY I had a convertible Mustang. It's junk, but a convertible is great for field work, no more "hey what flew over me?" as it disappears over the roof. I will say, of all my rental cars which all went a bit offroad, by far the worst was the BMW X5, absolutely horrible on gravel, dirt roads, etc.


HIGHLIGHTS of 2023:

1. Getting a very, very clear sighting up close of a Papilio that looks like machaon/ zelicaon, etc. near Bourne TX. AFAIK no such things exist there.

2. The one-day catch of over 20 Mid Summer Tigers in one spot in a couple hours, providing a spectacular sample for morphological variation studies, and comparison with appalachiensis, glaucus, and MST.


SUCKS, 2023:

1. Days in Huntsville, AL with zero sighting of a single Papilio of any species.

2. Still no DNA analysis from the pros from the 2022 specimens.

3. Just received bad news from my backup COI analyst, got a paying job so the 2023 specimens got bumped.

[Chuck]

OK, now I'm in way over my head.

I got some COI sequences, and was told they mark as canadensis. Which I am having a tough time with, given the location and date (August).

Specimen 1: AACATTATACTTTATTTTTGGAATTTGGGCAAGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCTTTAATATTAGGAGCACCTGATATAGCCTTTCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACTCTTTTAATTTCAAGAATAATCGTTGAAAGTGGAGCTGGAACTGGATGAACTGTTTATCCCCCTCTTTCTTCTAATATTGCTCATGGAAGAAGATCAGTAGATTTAGTTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCTTTATTATTACTTCTTTCATTACCTGTTTTAGCTGGAGCTATTACAATACTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Specimen 2:
AACATTATACTTTATTTTTGGAATTTGGGCAAGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCTTTAATATTAGGAGCACCTGATATAGCCTTTCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACTCTTTTAATTTCAAGAATAATCGTTGAAAGTGGAGCTGGAACTGGATGAACTGTTTATCCCCCTCTTTCTTCTAATATTGCTCATGGAAGAAGATCAGTAGATTTAGTTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCTTTATTATTACTTCTTTCATTACCTGTTTTAGCTGGAGCTATTACAATACTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

BOLD gives that a high of 100% and low of 98.3% compatibility with canadensis.

It's 100% match for the first few, then 99.54% for a bunch more. One of these 99.54% matches does have collecting data- in British Colombia.??

If "my" local MST were actually glaucus (as they've been considered forever) I'd expect a closer match with glaucus than with canadensis. There's no way these things are canadensis.

Ground pounder so confused.

[Chuck]

Growing less confused.

I looked at the BOLD images within the first ten 100% match. Sheds some light.

Match #2 Ontario CA, Wellington CA 15 April (??) April?? I think this is wrong.



Match #3 British Colombia



Match #7 Ontario CA, Grenville CO, 24 July



There's another specimen, looks very canadensis. But I'm seeing a trend here....these 100% match are not morphologically canadensis for the most part.


The BOLD tree for one of the specimens, if I read correctly that near-matches are in blue, would indicate that there are plenty of canadensis that aren't close to matching mine; also what is that split in canadensis near the bottom?

[Chuck]

I got three on iNat, one with COI. The other two COI is the same, and will be added by someone else.

https://www.inaturalist.org/observations/189581660

https://www.inaturalist.org/observations/189581411

https://www.inaturalist.org/observations/188565887

These, of course, COI closer to canadensis than glaucus.

So, what know is that in most of NY, parts of ON, PA, VT, MA the "Eastern Tiger Swallowtail" is not.

Some famous authors on Tigers believe that the spring form (e.g.,, late May) in most of NY is glaucus; I do not but don't have genetics for my early season specimens yet. MST in Ontario is univoltine, thus our MST should be as well, meaning it has a flight period of late May through early September- a very long flight period indeed.